Review




Structured Review

Twist Bioscience 12k array
12k Array, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/12k+array/12k+array/pm41175344-50-10-6
Average 86 stars, based on 1 article reviews
12k array - by Bioz Stars, 2026-09
86/100 stars

Images

Related Articles

Synthesized:

Article Title: RNA binding of GAPDH controls transcript stability and protein translation in acute myeloid leukemia.
Article Snippet: .. Individual sgRNA oligos were synthesized by Twist Bioscience on a 12K array and amplified using array primers (Array_Fwd: TTATATATCTTGTGGAAAGGACGAAACACCG; Array_Rev: AGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC). .. Individual sgRNA oligos were synthesized by Twist Bioscience on a 12K array and amplified using array primers (Array_Fwd: TTATATATCTTGTGGAAAGGACGAAACACCG; Array_Rev: AGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC).

Amplification:

Article Title: RNA binding of GAPDH controls transcript stability and protein translation in acute myeloid leukemia.
Article Snippet: .. Individual sgRNA oligos were synthesized by Twist Bioscience on a 12K array and amplified using array primers (Array_Fwd: TTATATATCTTGTGGAAAGGACGAAACACCG; Array_Rev: AGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC). .. Individual sgRNA oligos were synthesized by Twist Bioscience on a 12K array and amplified using array primers (Array_Fwd: TTATATATCTTGTGGAAAGGACGAAACACCG; Array_Rev: AGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC).



Similar Products

90
Thermo Fisher 12k flex 112-format open-array system
12k Flex 112 Format Open Array System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/12k+array/pmc11672409-216-46-49
Average 90 stars, based on 1 article reviews
12k flex 112-format open-array system - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

86
Twist Bioscience 12k array
12k Array, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/12k+array/12k+array/pm41175344-50-10-6
Average 86 stars, based on 1 article reviews
12k array - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

90
Thermo Fisher 12k flex 112-format open array system
12k Flex 112 Format Open Array System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/12k+array/pm39685910-76-50-54
Average 90 stars, based on 1 article reviews
12k flex 112-format open array system - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Thermo Fisher life 12k flex 112-format open array system
Life 12k Flex 112 Format Open Array System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/12k+array/pmc11642584-112-52-56
Average 90 stars, based on 1 article reviews
life 12k flex 112-format open array system - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Thermo Fisher quantstudio 12k flex open array real-time pcr system
Quantstudio 12k Flex Open Array Real Time Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/12k+array/pm38636197-55-39-47
Average 90 stars, based on 1 article reviews
quantstudio 12k flex open array real-time pcr system - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
INFINIUM Inc snp array infinium 12k v2 potato array
Snp Array Infinium 12k V2 Potato Array, supplied by INFINIUM Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/12k+array/12k+v2+potato+array/pmc10957621-319-22-21
Average 90 stars, based on 1 article reviews
snp array infinium 12k v2 potato array - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Thermo Fisher open array life quantstudio 12k
Open Array Life Quantstudio 12k, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/12k+array/open+array+life+quantstudio+12k/pm37940651-53-15-18
Average 90 stars, based on 1 article reviews
open array life quantstudio 12k - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
GenScript corporation 12k oligonucleotide array
12k Oligonucleotide Array, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/12k+array/12k+oligonucleotide+array/pm37792893-304-15-18
Average 90 stars, based on 1 article reviews
12k oligonucleotide array - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results